The most effective method to make the GSL work for you Platforms, Tools, and Services

Slide1 l.jpg
1 / 56
0
0
856 days ago, 243 views
PowerPoint PPT Presentation

Presentation Transcript

Slide 1

Step by step instructions to make the GSL work for you Platforms, Tools, and Services Jennifer Schaff, Interim Director Genomic Sciences Laboratory

Slide 2

The GSL is situated in the Partners II building, suite 2100 (Centennial Campus) Hours are 8:30am to 4:45pm Call ahead for help around lunch time gsl.cals.ncsu.edu

Slide 3

Services

Slide 4

Three accessible sequencing stages

Slide 5

Platform Reads/Run Read Length Data Yield ABI 3730 96-well 750-800 80Kb Roche GS FLX 1.2 million 350 400-600Mb Illumina GAIIx 20 million 36-108 more than 2Gb Three accessible sequencing stages

Slide 6

Platform Reads/Run Read Length Data Yield ABI 3730 96-well 750-800 80Kb Roche GS FLX 1.2 million 400-600Mb Illumina GAIIx 20 million 36-108 more than 2Gb Platform Throughput Price for every Experiment Price per Base ABI 3730 Low - Mid $ $$$ Roche GS FLX High $$$ $$ Illumina GAIIx Very High $$ $ Three accessible sequencing stages

Slide 7

G C T A C T G A How BigDye Terminating Chemistry Works A GCATGCTGACTGATCGTAGCTAGCT T A G T C A C G

Slide 8

G C T A C T G A How BigDye Terminating Chemistry Works A GCATGCTGACTGATCGTAGCTAGCT CTGACTA T A G T C A C G

Slide 9

G C T C T CT G CT G CT G CTG A CTG A CTGACTAGCATCGATCG T CTGACTAGCATCGATCG T How BigDye Terminating Chemistry Works GCATGCTGACTGATCGTAGCTAGCT CTGACTA . . .

Slide 10

G C T C T CT G CT G CT G CTG A CTG A CTGACTAGCATCGATCG T CTGACTAGCATCGATCG T How BigDye Terminating Chemistry Works GCATGCTGACTGATCGTAGCTAGCT CTGACTA . . .

Slide 11

How GS FLX 454 Chemistry Works http://www.454.com/items arrangements/sight and sound presentations.asp

Slide 12

How GS FLX 454 Chemistry Works

Slide 13

How GAIIx Chemistry Works

Slide 14

Sanger sequencing GS FLX 454 CGGAATAGTCTGTAGACGACTTCCGTTCCTGGCGGGGTGTTGTGCTCGGTAGAGCAGCGTCGTGCTGCGATCTGTTGAGACTCagCCCTACGCCAGgTGATTCGTCTACAGACTATTCCGAGCCccGACATCGAACTGAGGTAAATTCGGACCTTCGGAGCCGTGATGCACGCGTTAAGCGGACAGCATCGATCTCCGCGATCCAAATGGGCTTCGACGTCGCACCTCACGTGGTGAAGCGCGACTAGTAAAGTCACATTGTTTAGAGCCTCCCGACTCTCGGGGCTCCACAGTGAGCATATCCTTGCCGGATTCGGCTAGGCTGGCTTCGGCCTTAGAGGCGTTCAGGCATAATCCCGCGGATGGTAGCTTCGCACCACCGGCCGCTCGGCCGAGTGCATGAACCAAATGTCCGAAACTGCGGTTCCTCTCGTACTGAGCAGTATTACTATCGCAACGACAAGCCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAatCCCAGCTCACGTTCCCTTTTGATGGGTGAACAATCCAACGCTTGGCGAATTTTGCTTCGCAATGATAGGAAGAGCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGGCACCTCTTGCTAAAAACTCTTTATACTAAAGGATCGATAGGCCGTGCTTTCGCAGTCCCTATGCGTACTGAACATCTGGATCAAGCCAGCTTTTGCCCTTTTGCTCCACGCGAGGTTTCTGTCCTCGCTGAGCTGGCCTTAGGACACCTGCGTTATTCTTTGACAGATGTACCGCCCCAGTCAAACTACCCGCCTGGCAGTGTCCTCGAACCGGATCACGCGGGAGTTGTACGGCGACGAGCGTTGCCGCCACGTCGCCACTCTGCACGCTTGGAACGAAACACCGTGCGCCCGCCGATATTATCGACCGCGCACCGCTTCCGCCCAACCGAGTAAGTAATGAAACAATGAAAGTAG GAIIx

Slide 15

Single Molecule Sequencing Helicos - Short peruses ~ 50 bases Targeted sequencing Whole genome resequencing Digital transcriptome Pacific Biosystems - Long peruses ~ 1000 bases Full length transcriptome sequencing Whole genome resequencing ~Digital transcriptome

Slide 16

How Helicos Chemistry Works

Slide 18

How Pacific Biosystems "SMRT" Chemistry Works

Slide 20

Longer Read Coverage DNA Shorter Read Coverage Choosing the right stage Longer peruses gather simpler, and you require less scope… .

Slide 21

Longer Read Coverage DNA Shorter Read Coverage Choosing the right stage Longer peruses collect less demanding, and you require less scope… . In any case, at 4x more information for each run, 5-10x less expensive may make shorter read sequencing more alluring, and if doing a transcriptome, can get a thought of relative expression levels

Slide 22

Choosing the right stage Longer peruses collect less demanding, and you require less scope… . Longer Read Coverage DNA Shorter Read Coverage However, at 4x more information for each run, 5-10x less expensive may make shorter read sequencing more alluring, and if doing a transcriptome, can get a thought of relative expression levels

Slide 23

Choosing the right stage Paired End Sequencing DNA Paired End Sequencing

Slide 24

Paired End Sequencing DNA Paired End Sequencing Choosing the right stage Repetitive area Alternative joining

Slide 25

Sample Preparation – Starting Material* GS FLX (454) Genomic Sequencing – 500ng Transcript Sequencing – 200ng chose mRNA Illumina Genomic Sequencing – 500ng Transcript Sequencing – 1 to 10ug aggregate RNA *Amount of beginning material identifies with having enough to QC

Slide 26

Special Considerations for Transcript Sequencing

Slide 27

Transcript Sequencing OLD METHOD GS FLX 454: Introducing "transformations" into the polyA tail while orchestrating and opening up cDNA Requires Amplification Does not function admirably for either stage NEW METHOD: Chemical Fragmentation of mRNA Fragmentation (GS FLX 454) or add up to RNA (GAIIx) Starting material is 200ng** (GS FLX 454) or 1ug (GAIIx) Cannot standardize your transcripts

Slide 28

Transcript Sequencing - Normalization

Slide 29

Transcript Sequencing - Normalization

Slide 31

Using sequencing to discover SNV and different polymorphisms

Slide 32

Looking for SNPs (and different Polymorphs) Parents: VW8 and VW9 (subspecies of M. hapla ) AFLP: 4% of parts are polymorphic Infection on various plant species in tomato in root w/R VW8-VW9+ propagation on tomato w/R VW8+ VW9+ proliferation on bean VW8+ VW9+ multiplication on bean w/R VW8-VW9+ generation nightshade w/R VW8-VW9+ Aggregation VW8+ VW9-Small or no galls VW8-VW9+ Progeny: 183 F2 lines (subspecies of M. hapla )

Slide 33

Dr. Williamson, UC Davis - M. hapla linkage outline: AFLP/PCR markers LG1 LG3 LG2 LG4 LG5 LG10 LG11 LG9 LG8 LG7 LG6 LG12 Unmapped markers : ETCA/MCTC-185 ECGG/MACA-232 AF41a/b ECGG/MGA-150 ECGG/MAT-134 ECAT/MTG-125 ECAG/MACA-185 ECAA/MTG-133 AF16a/b AF19A/B LG15 LG14 EACC/MACT-120 EACC/MACT-105 EACC/MACC-100 AF12 AF28a/b ECA/MTA-80 EAT/MACT-95 LG13

Slide 34

Assembly Mh 1.3 of M. hapla (VW9) genome Opperman et al., PNAS Sept 30 th 2008 Total Number Bases 586,990,600 High Quality Reads 824,425 Genome secured by contigs >95% Genomic Coverage 10.4X Avg Read Length 712 (±199) Total Reads 1,013,681 Assembly Statistics Scaffolds >2kb 1,523 Scaffold length 53,578,246 Median framework length 83,645 Gaps 1,522 * Data amassed utilizing Arachne ( Genome Res. 2003 12:91-96)

Slide 35

Genomic DNA (pooled F2 lines) Reads 244,757 Bases (Mb) 61.1 Ave length 250 Coverage 1.1x Ave Scaffold Coverage* 49% VW8* sequencing information *from 0.9 to 100%

Slide 36

SNP location

Slide 37

Looking for SNPs (and different Polymorphisms) Parents: VW8 and VW9 AFLP: 4% of parts are polymorphic Infection on various plant species tomato w/R in root VW8-VW9+ multiplication on tomato w/R VW8+ VW9+ proliferation on bean VW8+ VW9+ propagation on bean w/R VW8-VW9+ nightshade w/R VW8-VW9+ Aggregation VW8+ VW9-Small or no galls *VW8-VW9+

Slide 38

F 2 lines vary in collection conduct A54 A16 C61 A31 No support – 24hr

Slide 39

total Aggregation propensity maps to LG8 (LOD 6 in view of 82 F2 lines and utilizing Joinmap)

Slide 40

Potential Aggregation SNP

Slide 41

anticipated protein [Nematostella vectensis]

Slide 42

accumulation Aggregation inclination maps to LG8 (LOD 6 in light of 82 F2 lines and utilizing Joinmap)

Slide 43

conglomeration Target Sequence Capture

Slide 44

The Agilent Technologies SureSelect™ Platform for Target Enrichment Focus your cutting edge sequencing on DNA that matters Now empowering considerably more cutting edge sequencing clients with an extended arrangement of target enhancement items!

Slide 45

Broad Paper on Cover of February, 2009 Nature Biotechnology Underlying Technology of SureSelect™ Target Enrichment System Agilent SureSelect™ Platform Enabling Products for the Next-Generation Sequencing Workflow Page 45

Slide 46

SureSelect DNA Capture Array Developed as a team with Cold Spring Harbor Dr. Greg Hannon et al. SureSelect Target Enrichment System* Developed in a joint effort with the Broad Institute Dr. Chad Nusbaum et al. Agilent's SureSelect™ Platform: New Options Agilent 60mer Array 1-5 µg gDNA (with WGA) 20 µg gDNA (unamplified) 1-3 µg gDNA Agilent SureSelect™ Platform Enabling Products for the Next-Generation Sequencing Workflow Page 46

Slide 47

SureSelect™ Target Enrichment System: Thermodynamic Equilibrium Displacement More lake, higher volume Pond overabundance overwhelms balance Small part of lake is caught (predisposition) High affectability to GC content à Redesign [Low] + strong stage = slower harmony More goad, low volume Bait abundance commands balance Large portion of lake is caught (less inclination) Less affectability to GC content [High] + arrangement stage = quick balance 10µg a couple pmol 0.5µg µg scale Array Prepped libraries 24 hours 72 hours Agilent SureSelect™ Platform Enabling Products for the Next-Generation Sequencing Workflow Page 47

Slide 48

SureSelect™ Target Enrichment System SureSelect™ DNA Capture Array Throughput High Low Study Sizes 10-1,000s specimens 1-10 tests (iterative outlines) gDNA Input 3 µg 3 µg Amplified library 500 ng 20 µg Automation perfect Yes No Capture of Target DNA 3.3 + Mb (2x tiling) (Custom 120-mer lures) 1Mb (20x tiling) (Custom 60-mer snares) Target enhancement items are customized to suit client extend needs

Slide 49

Sequencing advancements – the cutting edge Nature Reviews| Genetics Volume 11, January 2010

Slide 50

Genotyping

Slide 51

CATCATCATCAT CATCATCATCATCATCATCATCAT Genotyping Microsatellites/VNTR/STR

Slide 52

Genotyping Microsatellite/VNTR/STR AFLPs RAPDs TRFLP

Slide 53

Genotyping .:tsl

SPONSORS