Part 20 DNA Technology Genomics

Presentation Transcript

Section 20~ DNA Technology & Genomics Part 1: Basic Biotechnology

A Brave New World

TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT human genome 3.2 billion bases

Biotechnology today Genetic Engineering control of DNA in the event that you are going to specialist DNA & qualities & living beings, then you require an arrangement of instruments to work with this unit is an overview of those apparatuses… Our toolbox…

Bacteria audit one-celled prokaryotes imitate by mitosis paired splitting fast development era each ~20 minutes 10 8 (100 million) province overnight! predominant type of life on Earth extraordinarily assorted

Bacterial genome Single roundabout chromosome haploid exposed DNA no histone proteins ~4 million base sets ~4300 qualities 1/1000 DNA in eukaryote How have these little folks been able to be so differing??

Bacterial genome Single roundabout chromosome haploid stripped DNA no histone proteins ~4 million base sets ~4300 qualities 1/1000 DNA in eukaryote How have these little folks been able to be so different??

Plasmids Small supplemental circles of DNA 5000 - 20,000 base sets self-recreating convey additional qualities 2-30 qualities for anti-infection resistance can be traded between microscopic organisms bacterial sex!! quick advancement can be foreign made from environment

changed microorganisms quality from other living being recombinant plasmid cut DNA vector plasmid How can plasmids help us? An approach to get qualities into microbes effortlessly embed new quality into plasmid embed plasmid into microorganisms = vector microscopic organisms now communicates new quality microorganisms make new protein + stick DNA

Biotechnology Plasmids used to embed new qualities into microscopic organisms cut DNA quality we need like what? … insulin … HGH … lactase cut plasmid DNA Cut DNA? DNA scissors? ligase embed "quality we need" into plasmid... "stick" together recombinant plasmid

How would we cut DNA? Confinement catalysts limitation endonucleases found in 1960s advanced in microorganisms to cut up remote DNA "limit" the activity of the assaulting life form security against infections & other microbes microscopic organisms ensure their own DNA by methylation & by not utilizing the base groupings perceived by the compounds in their own particular DNA 

What do you see about these expressions? radar racecar Madam I'm Adam Able would i say i was ere I saw Elba a man, an arrangement, a waterway, Panama Was it a bar or a bat I saw? go hang a salami I'm a lasagna hoard palindromes

CT G | AATTC CG GA CTTAA | G GC Restriction chemicals Madam I'm Adam Action of catalyst cut DNA at particular successions limitation site symmetrical "palindrome" produces jutting closures sticky finishes will tie to any reciprocal DNA Many distinctive compounds named after creature they are found in EcoR I , Hind III , BamH I , Sma I  CT GAATTC CG GA CTTAAG GC 

Discovery of confinement proteins 1960s | 1978 Werner Arber Daniel Nathans Hamilton O. Smith Restriction catalysts are named for the living being they originate from: EcoR I = first confinement compound found in E. coli

GTAAC GAATTC ACGCTT CATTG CTTAAG TGCGAA GTAAC G AATTC ACGCTT CATTG CTTAA G TGCGAA Restriction compounds Cut DNA at particular locales leave "sticky closures" limitation catalyst cut site confinement chemical cut site

quality you need chromosome need to add quality to GGACCT G AATTC CGGATA CCTGGA CTTAA G GCCTAT GTAAC G AATTC ACGCTT CATTG CTTAA G TGCGAA GGACCT G AATTC ACGCTT CCTGGA CTTAA G TGCGAA consolidated DNA Sticky finishes Cut other DNA with same catalysts leave "sticky closures" on both can stick DNA together at "sticky finishes"

TTGTAAC GAATTC TACGAATGGTTACATCGCC GAATTC ACGCTT AACATTG CTTAAG ATGCTTACCAATGTAGCGG CTTAAG TGCGAA AATTC TACGAATGGTTACATCGCC G ATGCTTACCAATGTAGCGG CTTAA separated quality sticky finishes slice destinations chromosome need to add quality to AATGGTTACTTGTAAC G AATTC TACGATCGCCGATTCAACGCTT TTACCAATGAACATTG CTTAA G ATGCTAGCGGCTAAGTTGCGAA sticky finishes stick together chromosome with new quality included TAAC GAATTC TACGAATGGTTACATCGCC GAATTC TACGATC CATTG CTTAAG ATGCTTACCAATGTAGCGG CTTAAG ATGCTAGC Sticky closures stick qualities together cut destinations quality you need cut destinations Recombinant DNA atom DNA ligase joins the strands

TAAC GAATTC TACGAATGGTTACATCGCC GAATTC TACGATC CATTG CTTAAG ATGCTTACCAATGTAGCGG CTTAAG ATGCTAGC "new" protein from living being ex: human insulin from microscopic organisms aa Why combine qualities? By what method can microscopic organisms read human DNA? Quality produces protein in various living being or distinctive individual human insulin quality in microorganisms microscopic organisms human insulin

The code is all inclusive Since every living being… utilize a similar DNA utilize a similar code book read their qualities a similar way

Copy (& Read) DNA Transformation embed recombinant plasmid into microbes develop recombinant microorganisms in agar societies microbes make heaps of duplicates of plasmid " cloning " the plasmid generation of numerous duplicates of embedded quality creation of "new" protein changed phenotype DNA  RNA  protein  attribute

changed microorganisms quality from other living being recombinant plasmid + vector plasmid develop microbes gather (sanitize) protein Grow microbes… make more

Uses of hereditary building Genetically adjusted life forms (GMO) empowering plants to deliver new proteins Protect crops from bugs : BT corn creates a bacterial poison that murders corn borer (caterpillar vermin of corn) Extend developing season : fishberries strawberries with a hostile to solidifying quality from wallow Improve nature of nourishment : brilliant rice delivering vitamin An enhances wholesome esteem

Cut, Paste, Copy, Find… Word preparing illustration… cut confinement chemicals glue ligase duplicate plasmids bacterial change is there a simpler way?? find ????