Anticipating Lentiviral Vector Safety In Vivo

Presentation Transcript

Foreseeing Lentiviral Vector Safety In Vivo

Principal issues: Recombination and RCL In vitro QA/QC Status of field Tremendous advances in vector security outline while holding productive quality move in vivo. Challenges for clinical testing Devise an approach(s) for safe organization of vector

y LTR Prom. quality LTR Gag RRE CMV pA Pol CMV VSV-G pA Neither second nor third era vectors create RCL in vitro choke/choke pol-vector (env-less) recombinants can be delivered in essential transduced cells Emergence of RCL is the Principal Safety Concern (transduction/essential recombination) ? env-LTR-choke pol-env LTR-choke pol-LTR

Safety Considerations Genetic recombination likely - involvement with retrovirus vectors - used for invert translation supports era of RCL/wellbeing

in vitro RCL in vivo RCL X Safety Considerations Generation of RCL in vivo in vitro = era of LTR-muffle pol-env-LTR- like recombinants in vivo = disappointment in vector security and additionally QC

What Requisite Biosafety Measures QA/QC testing (LV stocks) a. PCR examine b. RCL measure c. Choke Pol recombinant measure

RCL examine Advantages: Detects replication skilled recombinants Disadvantages: Not prescient against the development of RCL in vivo Not educational of non-RCL recombinants ? Hereditary organization of recombinants ? Usefulness or replication capability of recombinants ? How the host will cooperate with the recombinants ? How recombinants will cooperate with host ? Hazard to the treated individual

PCR test Advantages: Detects vector-and additionally bundling particular DNA Disadvantages: Biologically non-particular Specificity

Gag-Pol Recombinant Assay Advantages : Enables checking of vector stocks for pre-RCR recombinants - Specifically, recombinants with an utilitarian stifler pol coding area Significance:

Gag-Pol Recombinant Assay Significance Shows choke pol-vector recombinants are created Without useful muffle pol (LTR-choke pol-LTR), RCL can't be produced in essential transduced cells Functional stifler pol is required for the recombinant to produce RCL in vivo Thus, in vitro observing for useful muffle pol-containing recombinants gives an unmistakable approach to examine LV stocks in vitro for their capability to create RCL in vivo

y LTR Prom. quality LTR Gag RRE CMV pA Pol CMV VSV-G pA Hypothesis Recombination QC surrogate (muffle pol recombinants) Recombination in vivo? RCL?

Analysis of Genetic Recombination Genetic Recombination Underpins the era of RCL Approach: Detect Enrich Characterize - hereditarily - organically

y LTR Ga puro LTR RRE Approach for Analyzing Genetic Recombination HeLa-puro

T a t Approach for Analyzing Genetic Recombination HeLa-puro Recombinant y LTR ga tat LTR y LTR ga RRE puro LTR puromycin Selection and portrayal of recombinant-containing cells

pol RRE pA CMV choke D U3 y ga RRE CMV R U5 trans - quality RSV R U5 rev ace SD pA RRE CMV choke pA RT IN vpr RRE LTR State-of-the-Art Vector Components third era bundling develop SIN vector Trans-lenti vector +

RT IN Pro Split Function Lentiviral Vector System Packaging Construct tat rev SD RRE poly A CMV choke tat Vector Construct y LTR Ga RRE CMV GFP LTR Env Construct CMV VSV-G poly A

LTR choke pol RRE Mock Lentiviral Vector - Nevirapine + Nevirapine 0 CFU 1000 CFU 0 CFU Lentiviral Vector tat Transfer HeLa-Puro tat 10 7 IU LTR-puro Puromycin Selection Generation of tat-containing recombinants

LTR choke pol RRE Lentiviral Vector choke Transfer HeLa-Puro 10 7 IU choke pol orf ? LTR-puro Infection Puromycin Selection pVSV-G ptat/rev Mock Lentiviral Vector - Nevirapine + Nevirapine 0 CFU 540 CFU 0 CFU Generation of recombinants with practical muffle pol hereditary structure

. . 2054 bp PCR U3 R U5 choke EXPAND Genetic Analysis of Recombinant Proviral DNA

5' Sequence Analysis of Genetic Recombinants orf (100%) R U5 choke

Recombination inside the Poly(A) Tract of the Packaging Construct Packaging build (47) (53) (63) mRNA … AAUGAAA… AAAAAAAAAAAAAAAAAAAAAA... (Dad flag) u3 r u5 cDNA RNA layout AAAA U3 R n Vector

(AAA) 47 (AAA) 53 (AAA) (AAA) 45 63 3' Sequence Analysis of Genetic Recombinants Packaging Construct (3' end) Vector (3' LTR) pA flag tat/rev U3 R U5 RRE 108 32 U3 PPT (x 6) AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA (x 1) AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA (x 1) AAGAGGAGGAGGAGGTGGG...GGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA (x 1) ATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGA

tat rev expert rev pA CMV RRE choke tat RRE Trans-Lentiviral Vector System Packaging develop Trans-protein build vpr pA RT IN LTR

LTR choke professional RRE 0 # provinces TLV Impairs Gag Transfer/DNA activation 10 7 IU HeLa-Puro LTR-puro ? Disease Puromycin choice pVSV-G ptat/rev Trans-lenti vector does not create discernible recombinants Block in DNA preparation due to trans-RT-IN Absence of practical Gag-Pol (RT-IN) pieces activation

Summary: Analysis of lentiviral vector Recombination happens between the lentiviral bundling build and quality exchange vector Integrated recombinants express popular proteins including, Tat, Gag, and the whole Gag-Pol forerunner polyprotein The declaration of the coordinated stifler and pol quality produces offspring env-lacking recombinant lentivirus particles These particles bundle mRNA and if pseudotyped, assemble the mRNA to other target cells where it is turn around deciphered and incorporated

Summary: Analysis of lentiviral vector Recombination inside the mRNA poly(A) tract: affirmed hereditary recombination amid invert interpretation in the contaminated cell proposed that expelling homologous successions from the vector and bundling develop may not be adequate to anticipate recombination may speak to a system by which qualities without homologous grouping can be activated, including endogenous qualities (Huang et al., Cell: 44:936, 1986; Raines et al., J. Virol. 62:2437, 1988)

D U3 y ga RRE CMV R U5 trans - quality RSV R U5 tat rev genius rev pA CMV RRE choke Tat-Independent Analysis of Genetic Recombination third era bundling build PR RT IN RRE pA CMV choke SIN vector Trans-lenti + vpr RT IN pA RRE LTR

y D U3 D U3 choke pol y LTR puro LTR Gag-Pol-Dependent DNA Mobilization Assay 10 8 - third gen. 10 8 - third gen/SIN 10 9 - trans-lenti HeLa-tat CMV-tat Recombinant y Infection pVSV-G Puromycin choice ptat/rev

third gen., vector third gen., Env Gag-Pol Dependent DNA Mobilization third gen. SIN + third gen. trans-lenti

Conclusions The third era bundling develop and SIN vector create recombinants with utilitarian muffle pol fit for activating DNA Separating RT and IN from the bundling build diminishes the recurrence of recovery of a practical stifler pol structure (and DNA preparation) by no less than 2 requests of extent Since a useful muffle pol hereditary structure is totally required for the era of RCL, m onitoring vector stocks for the creation of env-less stifler pol-containing recombinants may fill in as an in vitro surrogate marker to control against producing RCL in vivo. The trans-lentiviral vector configuration is especially managable for utilitarian stifler pol QC testing

Utility of in vitro checking for useful muffle pol-containing recombinants to QC against the capability of vector stocks to deliver RCL in vivo Theoretical ? Organically huge ?

Gp120-Receptor-Independent Mechanism(s) for HIV-1 Infection Cellular layer proteins are fused into virion amid growing (Arthur et al., Science 258:1935, 1992) The underlying official of HIV to target cells does not require Env-receptor collaboration (Mandor et al., J. Virol. 72:3623, 1998; Wu et al., submitted) Interaction between cell-inferred layer protein and receptor on cell surface encourages starting official (Wu et al., submitted) Interaction between cell-determined film protein and a cell receptor can bolster HIV-1 contamination (Enders et al., Science 278:1462, 1997; Mebatsion et al., cell 90:841, 1997; Schnell et al., Cell 90:849, 1997) HIV Env-autonomous disease of CD4-less epithelial cells (Duan et al., J. Virol. 74:10994, 2001)

y LTR choke pol choke pol Perpetuate Risk for RCL Env-less virions Infection Each cycle of replication speaks to an extra open door for hereditary recombination and the era of RCL

Analysis of Env-Minus Vector Infectivity Env-less vector CD4-less 1. Virion restricting 3. Section highway 4. Contamination/proviral arrangement 2. cDNA union

Attachment Independent of CD4 & gp120 HeLa CD4+ HeLa CD4-Env+ Env-

Vector DNA Synthesis Independent of gp120-CD4 Receptor-Mediated Entry 293 HeLa JC53 - + 3TC: - + Infection: R-U5 R-choke

Env+ Env- - + - + BFLA1: R-U5 Vector DNA Synthesis in Acidified Endosomes

Analysis of Vector Infectivity in CD4-less Cells HT-1080 Tu139 Vector particles HeLa JC53 BFLA1+ BFLA1 — BFLA1+ BFLA1 — D Env 4.8x10 2 7.3x10 3 3.3x10 3 2.8x10 3 0 Env 2.5x10 3 1.8x10 4 5.0x10 3 3.5x10 3 ND 1.5x10 5 VSV-G 7.7x10 4 2.4x10 6 ND

Nature Medicine 6:652, 2000 Science 283:682, 1999 Nature 406:82, 2000 Stem Ce