Advancement of sub-atomic methodologies in the investigation of lettuce wool buildup Bremia lactucae populace science P

Slide1 l.jpg
1 / 23
0
0
1119 days ago, 644 views
PowerPoint PPT Presentation
The indications are spotted, yellowed sores frequently precise that are bound by leaf veins. . Bremia lactucae (lettuce wool buildup) It is the pathogen causes genuine malady of lettuce that happens overall and lessens the yield.. Presentation. Malady cycle of wool buildup created by B. lactucae .

Presentation Transcript

Slide 1

Advancement of sub-atomic methodologies in the investigation of lettuce wool buildup ( Bremia lactucae ) populace science Presented by Limin Xu

Slide 2

Bremia lactucae (lettuce fleece mold) It is the pathogen causes genuine infection of lettuce that happens worldwide and diminishes the yield . The side effects are dotted, yellowed sores frequently rakish that are bound by leaf veins.

Slide 3

Disease cycle of wool mold created by B. lactucae Introduction Oomycete Obligate biotroph Specific host-pathogen connection appeared

Slide 4

Bremia lactucae disease of lettuce Resistance (DM) qualities recognized in lettuce and utilized as a part of reproducing However resistance patterns to separate quickly Host-pathogen cooperation showed Putative Avirulence (Avr) qualities distinguished (R. Michelmore, UC Davis)

Slide 5

Aim to explore the utilization of atomic techniques to study populace structures and the science of B. lactucae diseases on lettuce.

Slide 6

Objectives of current work 1. Set up a B.lactuace race ID framework utilizing differential test sets of lettuce assortments. 2. Build up the PCR-strategies to decide the hereditary changeability of B.lactuace separates. 3. Utilize atomic strategies to decide populace change of B.lactucae on various lettuce cultivars

Slide 7

B.lactuace race distinguishing proof framework utilizing differential test sets of lettuce assortments Nineteen lettuce cultivars' seedling can be developed in a container with division for B.lactucae race recognizable proof

Slide 8

Differential test set of 16 lettuce assortments.

Slide 9

Figure 1 . Division of B.lactucae secludes usually utilized as a part of rearing The differential test set of lettuce cultivars depends on that utilized by the International Bremia Evaluation Board (IBEB) (Arend et al., 2006). The aftereffects of the test give a one of a kind esteem for each segregate/race. Figure 1 is the division and ID of B.lactuace confines normally utilized as a part of reproducing which was additionally created by IBEB, a joint exertion of European lettuce raisers and experts since 1998.

Slide 10

Material and Methodology B. lactucae spores gathering : Culture on lettuce cv. Cobham Green to create spores for DNA extraction. Table1 . Separates data DNA are removed from the bubbled washed spores without leaves tissues.

Slide 11

Results of Race Identification Table2 . Consequences of the distinguishing proof Race ID utilizing differential lettuce cultivar is moderate. Require a fast strategy

Slide 12

ISSR Can be planned without the learning about microsatellite locales Good polymorphism and redundancy Can be produced to decide the hereditary changeability of B.lactucae

Slide 13

PCR base technique: utilizing the ISSR (Inter Simple Sequence Repeat) groundworks Table3. ISSR-groundworks for recognizable proof of B. Lactucae race, H= A, C, T; B=C, G, T; V=A, C, G; D=A, G, T (Wagner & Idczak, 2004)

Slide 14

Agarose gels couldn't separate the banding adequately The Elchrom 6% Poly(NAT)® prepared to-utilize gels in the size scope of 20 bp to 1,000 bp, were utilized to enhance the determination. Improvement gel electrophoresis

Slide 15

ISSR groundworks technique for race recognizable proof Cluster examination of banding examples demonstrated that the three separates were hereditarily particular

Slide 16

These three detaches are hereditarily distinctive . Cobham green did not demonstrate any banding designs. Along these lines, ISSR preliminaries are valuable sub-atomic markers on recognizing B. lactucae race.

Slide 17

Advantages and Disadvantages of ISSR demonstrate potential for race distinguishing proof ISSR groundworks is not species particular ISSR may not be strong for field recognition.

Slide 18

Possible Solution New wool buildup SSR "particular" preliminaries can be utilized to identify hereditary contrasts. 3 SSR groundworks are variable microsatellite loci in Plasmopara viticola yet they are additionally can be enhanced on B.lactucae as indicated by F.Delmotte's paper (2005): Pv14 L CAGAAACGCACAAGGTCTGA/Pv14 R AATTGCATACTGCAGCAACG Pv16 L TAAAAATATGGTGGCGTCAG/Pv16 RCCAGCAGTCTCCGTCTCATCAG Pv39 L ACGCATGGCGAACACGTAAG/Pv39 RCAGACGGGAAGAAGTTGCTC Work in progress utilizing these preliminaries to figure out whether they can distinguish variety between islates of B. lactucae

Slide 19

Future Marker Development SSR markers Screening B. lactucae genome library T he SSR advancement strategy Literature/database seeks Other sorts of markers E nd sequencing of fosmid clone – Allele sequencing? SNPs? K nown Bremia latucae Avr quality? (conjunction with R. Michelmore, UC-Davis )

Slide 20

Conclusion ISSR is helpful for B.lactucae race distinguishing proof in culture… … yet may not be vigorous for field concentrates wool mold particular markers are right now being worked on/being tried.

Slide 21

Future Work Collect more disconnects of B.lactucae from lettuce generation ranges and from wild lettuce. Test races utilizing the phenotypic cultivar race recognizable proof and contrast and sub-atomic techniques utilizing the ISSR markers. SSR markers improvement Commence utilizing markers for investigations of field populaces of B. lactucae.

Slide 22

Thanks Emily and Roy and every one of the associates in our gathering

Slide 23

Thank you

SPONSORS